Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249225

Morpholino Name: c2orf49 MO2
Synonyms: ashwin atg
Target mRNA: c2orf49

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGCACTGCCAACAGCTTTAGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/24
genomic

MO
5' TGGCTAAAGCTGTTGGCAGTGCTG 3' |||||||||||||||||||||| 3' TACGATTTCGACAACCGTCACGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:110345636..110345659 22/24 Antisense target c2orf49.L
chr3L:63596887..63596910 21/24 Sense off-target alg12.L
chr8L:90980282..90980305 20/24 Antisense off-target scfd1.L
Scaffold20:1688083..1688106 20/24 unknown
chr6S:15188985..15189008 20/24 unknown
tropicalis 10.0 Chr8:145852899..145852922 21/24 Antisense off-target efna3
Chr8:145852995..145853018 20/24 Antisense off-target efna3
Chr8:145853139..145853162 20/24 Antisense off-target efna3
Chr8:145853322..145853345 20/24 Antisense off-target efna3
Chr8:145853717..145853740 20/24 Antisense off-target efna3
Chr8:145853909..145853932 20/24 Antisense off-target efna3
Chr8:145853957..145853980 20/24 Antisense off-target efna3
Chr8:145854005..145854028 20/24 Antisense off-target efna3
Chr8:95375315..95375338 20/24 Sense off-target samd4a
Chr7:111008924..111008947 20/24 Antisense off-target prmt1
Chr8:145852755..145852778 20/24 Antisense off-target efna3
Chr8:145852851..145852874 20/24 Antisense off-target efna3
Chr5:119071309..119071332 20/24 unknown
Publications
First: Novel gene ashwin functions in Xenopus cell survival and anteroposterior patterning., Dev Dyn 2006                              
Most recent:
View All Papers