Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249234

Morpholino Name: casz1 MO1
Synonyms: casz1 MO ex9
Target mRNA: casz1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCTGCAAGGGAGAATCATTTGCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CAGCAAATGATTCTTCCTTGCAGAT 3' |||||||||||||| |||||||||| 3' GTCGTTTACTAAGAGGGAACGTCTA 5' 5' CAGCAAATGATTCTCCCTTGCAGAT 3' ||||||||||||||||||||||||| 3' GTCGTTTACTAAGAGGGAACGTCTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:66762600..66762624 25/25 Antisense target casz1.L
Chr8L:130309697..130309721 21/25 Antisense off-target XB5897201.L
Chr5L:121246153..121246177 21/25 unknown
tropicalis 10.0 Chr7:64234572..64234596 24/25 Antisense target casz1
Chr8:73752809..73752833 21/25 Antisense off-target tnxb
Chr7:113552517..113552541 21/25 unknown
Publications
First: Vertebrate CASTOR is required for differentiation of cardiac precursor cells at the ventral midline., Dev Cell 2008                                  
Most recent: Differential regulation of CASZ1 protein expression during cardiac and skeletal muscle development., Dev Dyn 2014                  
View All Papers