Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249235

Morpholino Name: casz1 MO2
Synonyms: casz1 MO ex8
Target mRNA: casz1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTATACAATTCAGTCCTACCTGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25 24/25
genomic

MO
5' GCCAGGTAGGACTAATTTGTATTAT 3' ||||||||||||| | |||||| | 3' CGGTCCATCCTGACTTAACATATTT 5' 5' GCCAGGTAGGACTGAATTGTATAAA 3' ||||||||||||||||||||||||| 3' CGGTCCATCCTGACTTAACATATTT 5' 5' GCCAGGTAGGACTGATTTGTATAAA 3' ||||||||||||||| ||||||||| 3' CGGTCCATCCTGACTTAACATATTT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:66763232..66763256 25/25 Antisense target casz1.L
Chr7S:52351907..52351931 24/25 Antisense target casz1.S
Chr4S:37811847..37811871 21/25 unknown
Chr4S:37811882..37811906 21/25 unknown
Chr6L:53396922..53396946 21/25 unknown
tropicalis 10.0 Chr7:64235261..64235285 21/25 Antisense target casz1
Chr4:76640354..76640378 21/25 Antisense off-target clca2
Chr3:119648635..119648659 21/25 unknown
Publications
First: Vertebrate CASTOR is required for differentiation of cardiac precursor cells at the ventral midline., Dev Cell 2008                                  
Most recent: Differential regulation of CASZ1 protein expression during cardiac and skeletal muscle development., Dev Dyn 2014                  
View All Papers