Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249256

Morpholino Name: cd44 MO1
Synonyms: XCD44-Mo1
Target mRNA: cd44

Morpholino Type: uncategorized morpholino
Sequence: 5' TGTGCTCCGCAGACAAGAGGCTCCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' AGGAGCCTCTTGTCTGCGGAACACA 3' |||||||||||||||||||| |||| 3' TCCTCGGAGAACAGACGCCTCGTGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:8040507..8040531 24/25 Antisense target cd44.L
tropicalis 10.0 Chr1:16369832..16369856 21/25 Sense off-target LOC101734035
Chr1:16511797..16511821 21/25 Sense off-target mid1l2
Publications
First: XHas2 activity is required during somitogenesis and precursor cell migration in Xenopus development., Development 2006                          
Most recent: Hyaluronan is required for cranial neural crest cells migration and craniofacial development., Dev Dyn 2012                
View All Papers