Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249260

Morpholino Name: cdc42 MO1
Synonyms: TGas029e03, XtCDC42, cdc42 MO
Target mRNA: cdc42

Morpholino Type: uncategorized morpholino
Sequence: 5' CTACACATTTAATTGTCTGCATGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GCCATGCAGACAATTAAATGTGTAG 3' ||||||||||||||||||||||||| 3' CGGTACGTCTGTTAATTTACACATC 5' 5' GCCATGCAGACAATTAAATGTGTAG 3' ||||||||||||||||||||||||| 3' CGGTACGTCTGTTAATTTACACATC 5' 5' GCCATGCAGACAATTAAATGTGTAG 3' ||||||||||||||||||||||||| 3' CGGTACGTCTGTTAATTTACACATC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:88494625..88494649 25/25 Antisense target cdc42.L
chr7S:63470604..63470628 25/25 Antisense target cdc42.S
chr9_10L:100371225..100371249 22/25 Antisense off-target rac1.L
chr9_10S:90135664..90135688 22/25 Antisense off-target rac3.S
chr8S:57734728..57734752 21/25 Antisense off-target dcx.S
chr3L:59267789..59267813 21/25 unknown
chr9_10S:50554686..50554710 21/25 unknown
tropicalis 10.0 Chr7:94430337..94430361 25/25 Antisense target cdc42
Chr9:25458708..25458732 22/25 Antisense off-target rac1
Chr4:123075302..123075326 21/25 Antisense off-target rac2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Regulation of neurogenesis by Fgf8a requires Cdc42 signaling and a novel Cdc42 effector protein., Dev Biol 2013                                
View All Papers