Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249266

Morpholino Name: cdh11 MO2
Synonyms: Xcad-11-MO, Xcad-11MO2, xcad-11 MO
Target mRNA: cdh11

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCTTGATAAATCCAGCGAATGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/24 24/24
genomic

MO
5' GACGTTAGCTGGATTTATCAAGCA 3' ||| || ||||||||||||||||| 3' CTGTAAGCGACCTAAATAGTTCGT 5' 5' GACATTCGCTGGATTTATCAAGCA 3' |||||||||||||||||||||||| 3' CTGTAAGCGACCTAAATAGTTCGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4S:37341957..37341980 24/24 Antisense target cdh11.S
chr2L:82316659..82316682 21/24 unknown
chr5S:69280584..69280607 21/24 unknown
chr2S:68836422..68836445 20/24 unknown
tropicalis 10.0 Chr4:56818600..56818623 22/24 Antisense target cdh11
Chr2:84556950..84556973 20/24 unknown
Chr3:53586038..53586061 20/24 unknown
Chr5:163545116..163545139 20/24 unknown
Publications
First: Cadherin-11 regulates protrusive activity in Xenopus cranial neural crest cells upstream of Trio and the small GTPases., Genes Dev 2009          
Most recent: The Rho guanine nucleotide exchange factor Trio is required for neural crest cell migration and interacts with Dishevelled., Development 2020                    
View All Papers