Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249267

Morpholino Name: cdh2 MO1
Synonyms: N-cad MO, N-cad-MO, N-cadherin, N-cadherinMO, Ncad, Ncad-MO, Nec2 MO
Target mRNA: cdh2

Morpholino Type: uncategorized morpholino
Sequence: 5' GAAGGGCTCTTTCCGGCACATGGTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' CACCATGTGCCGGAAAGAGCCCTTC 3' ||||||||||||||||||||||||| 3' GTGGTACACGGCCTTTCTCGGGAAG 5' 5' CACCATGTGCCGGAAAGAGCCCTTC 3' ||||||||||||||||||||||||| 3' GTGGTACACGGCCTTTCTCGGGAAG 5' 5' CACCATGTGCCGGAAACAGCCCTTC 3' |||||||||||||||| |||||||| 3' GTGGTACACGGCCTTTCTCGGGAAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:111109057..111109081 25/25 Antisense target cdh2.L
chr6S:88063483..88063507 24/25 Antisense target cdh2.S
chr1L:3598242..3598266 24/25 Antisense off-target LOC108697154
chr3L:56149267..56149291 23/25 Sense off-target pphln1.L
chr6L:130513740..130513764 23/25 Sense off-target laptm4b.L
chr7L:67184779..67184803 23/25 Antisense off-target prdm10.L
chr6L:141140802..141140826 24/25 unknown
tropicalis 10.0 Chr6:111096348..111096372 25/25 Antisense target cdh2
Chr1:14295546..14295570 21/25 unknown
Publications
First: N- and E-cadherins in Xenopus are specifically required in the neural and non-neural ectoderm, respectively, for F-actin assembly and morphogenetic movements., Development 2009                        
Most recent: Redistribution of Adhesive Forces through Src/FAK Drives Contact Inhibition of Locomotion in Neural Crest., Dev Cell 2018                                          
View All Papers