Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249271

Morpholino Name: cdknx MO1
Synonyms: Xic1 MO, p27Xic1, p27Xic1 MO
Target mRNA: cdknx

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGGGCGATGTGGAAAGCAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGGCTGCCTTCCACATCGCCCTGC 3' |||||||| |||||||||||||||| 3' TACCGACGAAAGGTGTAGCGGGACG 5' 5' ATGGCTGCTTTCCACATCGCCCTGC 3' ||||||||||||||||||||||||| 3' TACCGACGAAAGGTGTAGCGGGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:113248202..113248226 25/25 Antisense target cdknx.L
chr7S:84105713..84105737 25/25 Antisense off-target xicl
chr2S:86232345..86232369 21/25 unknown
tropicalis 10.0 Chr7:117636674..117636698 24/25 Antisense target cdknx
Chr7:83224243..83224267 21/25 Antisense off-target cadm1
Publications
First: The cdk inhibitor p27Xic1 is required for differentiation of primary neurones in Xenopus., Development 2003            
Most recent: Ascl1 phospho-status regulates neuronal differentiation in a Xenopus developmental model of neuroblastoma., Dis Model Mech 2015                  
View All Papers