Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249272

Morpholino Name: cdknx MO2
Synonyms:
Target mRNA: cdknx

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGGGCGATGTGGAAGGCAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' ATGGCTGCCTTCCACATCGCCCTGC 3' ||||||||||||||||||||||||| 3' TACCGACGGAAGGTGTAGCGGGACG 5' 5' ATGGCTGCTTTCCACATCGCCCTGC 3' |||||||| |||||||||||||||| 3' TACCGACGGAAGGTGTAGCGGGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:113248202..113248226 24/25 Antisense target cdknx.L
chr7S:84105713..84105737 24/25 Antisense off-target xicl
chr7L:78235951..78235975 21/25 Antisense off-target il18.L
tropicalis 10.0 Chr7:117636674..117636698 25/25 Antisense target cdknx
Publications
First: Depletion of the cell-cycle inhibitor p27(Xic1) impairs neuronal differentiation and increases the number of ElrC(+) progenitor cells in Xenopus tropicalis., Mech Dev 2003              
Most recent:
View All Papers