Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249289

Morpholino Name: chaf1a MO1
Synonyms: p150
Target mRNA: chaf1a

Morpholino Type: uncategorized morpholino
Sequence: 5' TACTGCTGCTTCCTTCCCAGGCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genomic

MO
5' GATGCCTGGGAAGGAAGCGACAGGA 3' |||||||||||||||||| ||| | 3' CTACGGACCCTTCCTTCGTCGTCAT 5' 5' GATGCCTGGGAAGGAAGCAGCAGTA 3' ||||||||||||||||||||||||| 3' CTACGGACCCTTCCTTCGTCGTCAT 5' 5' GATGCCTGGGAAGGAAGCAGCAGGA 3' ||||||||||||||||||||||| | 3' CTACGGACCCTTCCTTCGTCGTCAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:89907410..89907434 25/25 Antisense target chaf1a.L
chr1S:78866697..78866721 24/25 Antisense target chaf1a.S
chr8L:3597859..3597883 21/25 Antisense off-target LOC108698179 [provisional:camsap1]
chr4L:123531871..123531895 21/25 unknown
chr6S:120802580..120802604 21/25 unknown
tropicalis 10.0 Chr1:93821843..93821867 22/25 Antisense target chaf1a
Chr6:38443676..38443700 21/25 Sense off-target LOC108647894
Chr1:68227289..68227313 21/25 unknown
Chr8:107236035..107236059 21/25 unknown
Publications
First: A developmental requirement for HIRA-dependent H3.3 deposition revealed at gastrulation in Xenopus., Cell Rep 2012                                        
Most recent:
View All Papers