Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249315

Morpholino Name: creb3l2 MO1
Synonyms: creb3l2 A MO
Target mRNA: creb3l2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCCCACTCTCCATTATTTCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 21/25
genomic

MO
5' CATGGAAATAATGGAGAGTGGGGAT 3' |||||||||||||||||||||||| 3' CTACCTTTATTACCTCTCACCCCTA 5' 5' GATGGAAATAATGGAGAGTGGGGAT 3' ||||||||||||||||||||||||| 3' CTACCTTTATTACCTCTCACCCCTA 5' 5' CATGGAAATAATGGAGAGCTGCGAT 3' ||||||||||||||||| | ||| 3' CTACCTTTATTACCTCTCACCCCTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold31:344917..344941 25/25 Antisense target creb3l2.L
chr3S:3473943..3473967 21/25 Antisense target creb3l2.S
chr2L:85912441..85912465 21/25 Sense off-target csmd2.L
chr2L:85912441..85912465 21/25 Sense off-target LOC108708256 [provisional:csmd2]
chr3S:49268934..49268958 21/25 unknown
chr6S:39950851..39950875 21/25 unknown
chr8L:37778696..37778720 21/25 unknown
tropicalis 10.0 Chr3:5823164..5823188 24/25 Antisense target creb3l2
Chr6:42961600..42961624 21/25 Sense off-target creb5
Chr6:134644185..134644209 21/25 unknown
Publications
First: Coordinated activation of the secretory pathway during notochord formation in the Xenopus embryo., Development 2009        
Most recent:
View All Papers