Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249316

Morpholino Name: creb3l2 MO2
Synonyms: creb3l2 B MO
Target mRNA: creb3l2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCGCAGCTCTCCATTATTTCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 21/25 25/25
genomic

MO
5' CATGGAAATAATGGAGAGTGGGGAT 3' |||||||||||||||||| | ||| 3' GTACCTTTATTACCTCTCGACGCTA 5' 5' GATGGAAATAATGGAGAGTGGGGAT 3' ||||||||||||||||| | ||| 3' GTACCTTTATTACCTCTCGACGCTA 5' 5' CATGGAAATAATGGAGAGCTGCGAT 3' ||||||||||||||||||||||||| 3' GTACCTTTATTACCTCTCGACGCTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:3473943..3473967 25/25 Antisense target creb3l2.S
Scaffold31:344917..344941 21/25 Antisense target creb3l2.L
chr6S:35660113..35660137 21/25 Sense off-target LOC108719945 [provisional:rftn1]
tropicalis 10.0 Chr3:5823164..5823188 22/25 Antisense target creb3l2
Chr1:190007967..190007991 21/25 Sense off-target pde4d
Chr6:134644185..134644209 21/25 unknown
Publications
First: Coordinated activation of the secretory pathway during notochord formation in the Xenopus embryo., Development 2009        
Most recent:
View All Papers