Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249375

Morpholino Name: dhrs3 MO2
Synonyms: SDR
Target mRNA: dhrs3

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTGCCCACTGAGCGCATATCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATGGATATGCGCTCAGTGGGCAGG 3' ||||||||||||||||||||||||| 3' GTACCTATACGCGAGTCACCCGTCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:38069636..38069660 21/25 Antisense off-target nos2.S
tropicalis 10.0 Chr7:95728376..95728400 25/25 Antisense target dhrs3
Chr6:25992433..25992457 21/25 Antisense off-target kiaa1217
Chr7:8625404..8625428 21/25 Antisense off-target LOC116412053
Chr2:164185926..164185950 22/25 unknown
Chr2:164185905..164185929 21/25 unknown
Publications
First: Microarray-based identification of VegT targets in Xenopus., Mech Dev 2005                                            
Most recent:
View All Papers