Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249382

Morpholino Name: dlc MO1
Synonyms: 870, Delta-2 MO2, X-Delta-2 MO2
Target mRNA: dlc

Morpholino Type: uncategorized morpholino
Sequence: 5' AGACTTGTATCGGGAGTTCCAGAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTTCTGGAACTCCCGATACAAGTCT 3' ||||||||||||||||||||||||| 3' AAAGACCTTGAGGGCTATGTTCAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:59513315..59513339 25/25 Antisense target dlc.L
chr1L:163926989..163927013 22/25 Antisense off-target sh2b3.L
chr8L:106983075..106983099 21/25 Antisense off-target XB5762037.L [provisional]
Publications
First: Interaction between X-Delta-2 and Hox genes regulates segmentation and patterning of the anteroposterior axis., Mech Dev 2006                            
Most recent:
View All Papers