Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249383

Morpholino Name: dlc MO2
Synonyms: Delta-2 MO1, X-Delta-2 MO1, X-delta-2
Target mRNA: dlc

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGGCAGTCTCCTGGCACTGACAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTGTCAGTGCCAGGAGACTGCCATG 3' ||||||||||||||||||||||||| 3' AACAGTCACGGTCCTCTGACGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:59513346..59513370 25/25 Antisense target dlc.L
chr1L:199987784..199987808 21/25 Antisense off-target LOC108718400 [provisional:plcxd3]
chr8L:9141845..9141869 21/25 Sense off-target dennd1a.L
tropicalis 10.0 Chr1:121336535..121336559 21/25 unknown
Publications
First: Role of X-Delta-2 in the early neural development of Xenopus laevis., Dev Dyn 2006                                                
Most recent: Perturbation of Notch/Suppressor of Hairless pathway disturbs migration of primordial germ cells in Xenopus embryo., Dev Growth Differ 2010  
View All Papers