Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249389

Morpholino Name: dmrta1 MO1
Synonyms: Dmrt4-MO, XDmrt4
Target mRNA: dmrta1

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGTTTGGGCTTTTGCAGTCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genomic

MO
5' CATGGACTGCAAAAGCCCAAACATT 3' |||||||||||||||||||||||| 3' GTACCTGACGTTTTCGGGTTTGTAC 5' 5' CATGGACTGCAAAAACCCAAACATG 3' |||||||||||||| |||||||||| 3' GTACCTGACGTTTTCGGGTTTGTAC 5' 5' CATGGACTGCAAAAGCCCAAACATG 3' ||||||||||||||||||||||||| 3' GTACCTGACGTTTTCGGGTTTGTAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1S:98269688..98269712 25/25 Antisense target dmrta1.S
chr1L:118854419..118854443 24/25 Antisense target dmrta1.L
chr8S:11123433..11123457 21/25 Sense off-target XB5959262.S [provisional:lbh]
chr1L:41187132..41187156 21/25 Antisense off-target asb5.L
tropicalis 10.0 Chr1:121361071..121361095 24/25 Antisense target dmrta1
Chr7:31481358..31481382 21/25 Antisense off-target kcnip2
Publications
First: The doublesex-related gene, XDmrt4, is required for neurogenesis in the olfactory system., Proc Natl Acad Sci U S A 2005                          
Most recent: The Xenopus doublesex-related gene Dmrt5 is required for olfactory placode neurogenesis., Dev Biol 2013                                
View All Papers