Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249396

Morpholino Name: dnal1 MO1
Synonyms: TGas030a23, XtLueRDLC, aD1LC
Target mRNA: dnal1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTTAATGGTTGTTGCTTTTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 21/25
genomic

MO
5' CAGGCAAAAGCAACAACCATTAAAG 3' ||||||||||||||||||||||| 3' TACCGTTTTCGTTGTTGGTAATTTC 5' 5' CAGGCAAAAGCAACAACCATAAAGG 3' |||||||||||||||||| || | 3' TACCGTTTTCGTTGTTGGTAATTTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:82745785..82745809 21/25 Antisense target dnal1.L
chr8L:82745785..82745809 21/25 Antisense off-target lrrc57.L
Scaffold162:50799..50823 21/25 Antisense off-target Xelaev18000422m
chr7L:52677502..52677526 21/25 Sense off-target slc43a1.L
chr8L:19219920..19219944 21/25 Antisense off-target brinp1.L
chr8S:65489948..65489972 22/25 unknown
chr1L:160789456..160789480 22/25 unknown
Scaffold60:238549..238573 21/25 unknown
chr3L:48798497..48798521 21/25 unknown
tropicalis 10.0 Chr8:105633944..105633968 23/25 Antisense target dnal1
Chr3:48617527..48617551 21/25 Sense off-target ano4
Chr1:23419412..23419436 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers