Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249432

Morpholino Name: egfl7 MO1
Synonyms: miR-126 MO
Target mRNA: egfl7

Morpholino Type: uncategorized morpholino
Sequence: 5' TGACACAGCGCGTACCAAAAGTAAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATTACTTTTGGTACGCGCTGTGTCA 3' ||||||||||||||||||||||||| 3' TAATGAAAACCATGCGCGACACAGT 5' 5' ATTACTTTTGGTACGCGCTGTGTCA 3' ||||||||||||||||||||||||| 3' TAATGAAAACCATGCGCGACACAGT 5' 5' ATTACTTTTGGTACGCGCTGTGTCA 3' ||||||||||||||||||||||||| 3' TAATGAAAACCATGCGCGACACAGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:4518740..4518764 25/25 Antisense target egfl7.L
Chr8S:29414375..29414399 25/25 Antisense target egfl7.S
tropicalis 10.0 Chr8:6847982..6848006 25/25 Antisense target egfl7
Chr8:6847982..6848006 25/25 Antisense off-target mir126
Publications
First: CASZ1 promotes vascular assembly and morphogenesis through the direct regulation of an EGFL7/RhoA-mediated pathway., Dev Cell 2013          
Most recent: A distinct mechanism of vascular lumen formation in Xenopus requires EGFL7., PLoS One 2015                
View All Papers