Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249433

Morpholino Name: egfl7 MO2
Synonyms: egfl7 MO
Target mRNA: egfl7

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGCACTAAAGAGAGAGACACAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTTGTGTCTCTCTCTTTAGTGCTGT 3' ||||||||||||||||||||||||| 3' GAACACAGAGAGAGAAATCACGACA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:4514247..4514271 25/25 Antisense target egfl7.L
Chr1S:8031757..8031781 22/25 Sense off-target LOC108706501
Chr3L:69606282..69606306 21/25 Antisense off-target LOC108710259
Chr4L:146435814..146435838 21/25 Antisense off-target atxn7.L
Chr5S:141670494..141670518 21/25 Antisense off-target LOC108717456
Chr2S:65015458..65015482 22/25 unknown
Chr3L:87286013..87286037 22/25 unknown
Chr8S:23001322..23001346 22/25 unknown
Chr2S:165922527..165922551 22/25 unknown
Chr7L:43425621..43425645 21/25 unknown
Chr8L:57275884..57275908 21/25 unknown
tropicalis 10.0 Chr6:24972682..24972706 21/25 Sense off-target abi1
Chr8:104598554..104598578 21/25 Antisense off-target atg14
Chr1:33184729..33184753 21/25 unknown
Chr3:28641017..28641041 21/25 unknown
Chr5:163277061..163277085 21/25 unknown
Chr6:1845965..1845989 21/25 unknown
Publications
First: CASZ1 promotes vascular assembly and morphogenesis through the direct regulation of an EGFL7/RhoA-mediated pathway., Dev Cell 2013          
Most recent: A distinct mechanism of vascular lumen formation in Xenopus requires EGFL7., PLoS One 2015                
View All Papers