Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249446

Morpholino Name: enpp2 MO1
Synonyms: autotaxin MO
Target mRNA: enpp2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CTGAATCCGTTTTTCATTGCCATAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CTATGGCAATGAAAAACGGATTCAG 3' ||||||||||||||||||||||||| 3' GATACCGTTACTTTTTGCCTAAGTC 5' 5' CTATGGCAATGAAAAACGGATTCAG 3' ||||||||||||||||||||||||| 3' GATACCGTTACTTTTTGCCTAAGTC 5' 5' CTATGGCAATGAAAAACGGATTCAG 3' ||||||||||||||||||||||||| 3' GATACCGTTACTTTTTGCCTAAGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:139859551..139859575 25/25 Antisense target enpp2.L
chr6S:115581534..115581558 25/25 Antisense target enpp2.S
chr1S:28199234..28199258 21/25 Sense off-target ociad1.S
tropicalis 10.0 Chr6:138216135..138216159 25/25 Antisense target enpp2
Publications
First: An essential role for LPA signalling in telencephalon development., Development 2014                              
Most recent: In vivo collective cell migration requires an LPAR2-dependent increase in tissue fluidity., J Cell Biol 2014                                  
View All Papers