Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249476

Morpholino Name: eya1 MO1
Synonyms: Eya1MO1
Target mRNA: eya1

Morpholino Type: uncategorized morpholino
Sequence: 5' TACTATGTGGACTGGTTAGATCCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CAGGATCTAGCCAGTCCACATAGTA 3' ||||||||| ||||||||||||||| 3' GTCCTAGATTGGTCAGGTGTATCAT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr6:120549360..120549384 24/25 Antisense target eya1
Publications
First: Eya1 and Six1 promote neurogenesis in the cranial placodes in a SoxB1-dependent fashion., Dev Biol 2008                    
Most recent: Otic Neurogenesis in Xenopus laevis: Proliferation, Differentiation, and the Role of Eya1., Front Neuroanat 2021                                                      
View All Papers