Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249477

Morpholino Name: eya1 MO2
Synonyms: Eya1MO2
Target mRNA: eya1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATATTTGTTCTGTCAGTGGCAAGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 24/25 22/25
genomic

MO
5' GACTTGTTACTGACAGAACAGATAT 3' |||||| |||||||||||| |||| 3' CTGAACGGTGACTGTCTTGTTTATA 5' 5' GACTTGCCACTGACAGAACAGATAT 3' |||||||||||||||||||| |||| 3' CTGAACGGTGACTGTCTTGTTTATA 5' 5' GATTTGTCACTGACAGAACAGATAT 3' || ||| ||||||||||||| |||| 3' CTGAACGGTGACTGTCTTGTTTATA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:129159528..129159552 24/25 Antisense target eya1.L
Chr6S:106200439..106200463 22/25 Antisense target eya1.S
Chr1S:19883800..19883824 21/25 Sense off-target slit2.S
Chr2L:1346291..1346315 21/25 Sense off-target gsk3b.L
Chr4S:70689525..70689549 21/25 unknown
Chr6S:69489556..69489580 21/25 unknown
tropicalis 10.0 Chr6:120555742..120555766 22/25 Antisense target eya1
Publications
First: Eya1 and Six1 promote neurogenesis in the cranial placodes in a SoxB1-dependent fashion., Dev Biol 2008                    
Most recent: Otic Neurogenesis in Xenopus laevis: Proliferation, Differentiation, and the Role of Eya1., Front Neuroanat 2021                                                      
View All Papers