Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249500

Morpholino Name: fgf8 MO1
Synonyms: F8MO, FGF8-AMO, FGF8a MO, Fgf8MO, XIMOF8
Target mRNA: fgf8

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGAGGTGATGTAGTTCATGTTGCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAGCAACATGAACTACATCACCTCC 3' ||||||||||||||||||||||||| 3' CTCGTTGTACTTGATGTAGTGGAGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:25383706..25383730 25/25 Antisense target fgf8.L
chr6L:34020463..34020487 22/25 unknown
chr3S:50868626..50868650 21/25 unknown
chr7S:74650255..74650279 21/25 unknown
Publications
First: Msx1 and Pax3 cooperate to mediate FGF8 and WNT signals during Xenopus neural crest induction., Dev Cell 2005              
Most recent: PFKFB4 control of AKT signaling is essential for premigratory and migratory neural crest formation., Development 2017                                  
View All Papers