Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249516

Morpholino Name: fli1 MO1
Synonyms: Fli1 MO, XlFliMO
Target mRNA: fli1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCTTAATGGTTCCGTCCATGTGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 23/25 24/25
genomic

MO
5' GACACATGGACGGCACCATTAAGGT 3' ||||||||||||| |||||||||| 3' CTGTGTACCTGCCTTGGTAATTCCT 5' 5' GACACATGGACGGGACCATTAAGGT 3' ||||||||||||| |||||||||| 3' CTGTGTACCTGCCTTGGTAATTCCT 5' 5' GACACATGGACGGAACCATTAAGGT 3' |||||||||||||||||||||||| 3' CTGTGTACCTGCCTTGGTAATTCCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7S:47388517..47388541 24/25 Antisense target fli1.S
chr7L:66350752..66350776 23/25 Antisense target fli1.L
chr4S:16867725..16867749 21/25 unknown
tropicalis 10.0 Chr7:72263291..72263315 23/25 Antisense target fli1
Chr6:106947333..106947357 21/25 Sense off-target myl12b
Publications
First: Xapelin and Xmsr are required for cardiovascular development in Xenopus laevis., Dev Biol 2006                  
Most recent: VEGFA-dependent and -independent pathways synergise to drive Scl expression and initiate programming of the blood stem cell lineage in Xenopus., Development 2013                                                                                                                              
View All Papers