Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249529

Morpholino Name: fos MO1
Synonyms: XFos-MO
Target mRNA: fos

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCTGGAGAAGGCGTGATACATGAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' ACCATGTATCACGCCTTCTCCAGCA 3' | ||||||||||||||||||||||| 3' TAGTACATAGTGCGGAAGAGGTCGT 5' 5' ATCATGTATCACGCCTTCTCCAGCA 3' ||||||||||||||||||||||||| 3' TAGTACATAGTGCGGAAGAGGTCGT 5' 5' ATCATGTATCACGCCTTCTCCAGCA 3' ||||||||||||||||||||||||| 3' TAGTACATAGTGCGGAAGAGGTCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:60010662..60010686 25/25 Antisense target fos.L
chr8S:25642318..25642342 25/25 Antisense target fos.S
chr4S:72151718..72151742 22/25 Sense off-target cop1.S
chr3L:34570281..34570305 21/25 Antisense off-target ubtd2.L
chr2S:7145682..7145706 21/25 unknown
chr6L:142623723..142623747 21/25 unknown
tropicalis 10.0 Chr8:82312493..82312517 24/25 Antisense target fos
Publications
First: Regulation of ERK activity duration by Sprouty contributes to dorsoventral patterning., Nat Cell Biol 2009  
Most recent:
View All Papers