Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249541

Morpholino Name: foxf1 MO1
Synonyms: FoxF1 morpholino oligonucleotides, FoxF1Mo
Target mRNA: foxf1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTGAAGAAAATAGGGAAAGCTGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' TCAGCTTTCCTCATTTTCTTCAGCT 3' |||||||||| ||||||||||||| 3' AGTCGAAAGGGATAAAAGAAGTCGA 5' 5' TCAGCTTTCCCTATTTTCTTCAGCT 3' ||||||||||||||||||||||||| 3' AGTCGAAAGGGATAAAAGAAGTCGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:46029782..46029806 25/25 Antisense target foxf1.S
Chr1L:229552641..229552665 22/25 Sense off-target LOC108718850
Chr1L:229552755..229552779 22/25 Sense off-target LOC108718850
Chr1L:228308283..228308307 21/25 Sense off-target celf4.L
Chr1S:2864997..2865021 21/25 Antisense off-target LOC108704059
Chr2S:87362126..87362150 21/25 Sense off-target doc2b.S
Chr3S:4169378..4169402 21/25 Antisense off-target LOC108712551
Chr3S:4169473..4169497 21/25 Antisense off-target LOC108712551
Chr3S:4169511..4169535 21/25 Antisense off-target LOC108712551
Chr3S:4169586..4169610 21/25 Antisense off-target LOC108712551
Chr3S:4169767..4169791 21/25 Antisense off-target LOC108712551
Chr3S:65907746..65907770 21/25 Antisense off-target LOC108713037
Chr3S:8891338..8891362 21/25 Antisense off-target LOC108712590
Chr4L:124432623..124432647 21/25 Antisense off-target dag1.L
Chr5S:29444498..29444522 21/25 Sense off-target LOC108717769
Chr7S:2513513..2513537 21/25 Antisense off-target LOC108697311
Chr8S:31660672..31660696 21/25 Antisense off-target ralgds.S
Chr5S:139530432..139530456 22/25 unknown
Chr9_10L:51731204..51731228 22/25 unknown
Chr1L:232431181..232431205 21/25 unknown
Chr2L:95962235..95962259 21/25 unknown
Chr3L:297639..297663 21/25 unknown
Chr7L:139403799..139403823 21/25 unknown
Chr7L:2586467..2586491 21/25 unknown
Chr7S:84057745..84057769 21/25 unknown
Chr9_10L:60273887..60273911 21/25 unknown
tropicalis 10.0 Chr4:64370109..64370133 23/25 Antisense target foxf1
Chr7:13556426..13556450 21/25 Sense off-target prkg1
Chr9:5715524..5715548 22/25 unknown
Chr8:143670078..143670102 21/25 unknown
Publications
First: Function and regulation of FoxF1 during Xenopus gut development., Development 2004                  
Most recent:
View All Papers