Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249542

Morpholino Name: foxf1 MO2
Synonyms: FoxF1 morpholino oligonucleotides, second FoxF1Mo
Target mRNA: foxf1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGGATAAGAGCCCCTCAGTCTGCAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTGCAGACTGAGGGGCTCTTATCCT 3' ||||||||||||||||||||||||| 3' CACGTCTGACTCCCCGAGAATAGGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:46029829..46029853 25/25 Antisense target foxf1.S
Chr5S:46483607..46483631 21/25 Antisense off-target pde10a.S
Publications
First: Function and regulation of FoxF1 during Xenopus gut development., Development 2004                  
Most recent:
View All Papers