Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249583

Morpholino Name: fzd3 MO1
Synonyms: Xfz3, Xfz3 MO, fz3, fzd3 MO
Target mRNA: fzd3

Morpholino Type: translation blocking morpholino
Sequence: 5' CGCAAAGCCACATGCACCTCTTGAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTCAAGAGGTGCATGTGGCTTTGCG 3' ||||||||||||||||||||||||| 3' AAGTTCTCCACGTACACCGAAACGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:163865085..163865109 25/25 Antisense target fzd3.L
Chr1S:48267928..48267952 21/25 unknown
Publications
First: A role for frizzled 3 in neural crest development., Development 2001        
Most recent: Frizzled 3 acts upstream of Alcam during embryonic eye development., Dev Biol 2017                          
View All Papers