Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249604

Morpholino Name: gata2 MO2
Synonyms: GATA-2b
Target mRNA: gata2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTCAGTAGCCACTTCCATTGCAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 23/25 25/25
genomic

MO
5' CTCGCAATGGAAGTGGCTACTGACC 3' | |||||||||||||||||||||| 3' GGACGTTACCTTCACCGATGACTGG 5' 5' CCTGCGATGGAAGTGGCCACTGACC 3' ||||| ||||||||||| ||||||| 3' GGACGTTACCTTCACCGATGACTGG 5' 5' CCTGCAATGGAAGTGGCTACTGACC 3' ||||||||||||||||||||||||| 3' GGACGTTACCTTCACCGATGACTGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4S:108208994..108209018 25/25 Antisense target gata2.S
chr4L:130236805..130236829 23/25 Antisense target gata2.L
chr6L:58442463..58442487 21/25 Antisense off-target grb10.L
tropicalis 10.0 Chr4:135414993..135415017 23/25 Antisense target gata2
Publications
First: GATA-2 functions downstream of BMPs and CaM KIV in ectodermal cells during primitive hematopoiesis., Dev Biol 2007  
Most recent: Tril targets Smad7 for degradation to allow hematopoietic specification in Xenopus embryos., Development 2016                              
View All Papers