Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249608

Morpholino Name: gata4 MO3
Synonyms: GATA4 MO, gata4
Target mRNA: gata4

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTATACTCTGATACATCCTGATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 22/25 25/25
genomic

MO
5' TGCCAGGATGTATCAGAGTATAGCT 3' |||||||||||||||||||||| 3' CTAGTCCTACATAGTCTCATATCGA 5' 5' TGCCAGGATGTATCAGAGTATAGCT 3' |||||||||||||||||||||| 3' CTAGTCCTACATAGTCTCATATCGA 5' 5' GATCAGGATGTATCAGAGTATAGCT 3' ||||||||||||||||||||||||| 3' CTAGTCCTACATAGTCTCATATCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:130398881..130398905 25/25 Antisense target gata4.S
chr5L:151179454..151179478 22/25 Antisense target gata4.L
chr1L:16749089..16749113 21/25 Sense off-target sorcs2.L
tropicalis 10.0 Chr5:150641385..150641409 22/25 Antisense target gata4
Chr5:150641385..150641409 22/25 Sense off-target fam167a
Publications
First: GATA4, 5 and 6 mediate TGFbeta maintenance of endodermal gene expression in Xenopus embryos., Development 2005            
Most recent: sfrp1 promotes cardiomyocyte differentiation in Xenopus via negative-feedback regulation of Wnt signalling., Development 2013                                      
View All Papers