Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249609

Morpholino Name: gata4 MO4
Synonyms: G4SP MO, GATA4 sp
Target mRNA: gata4

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGCAGACTAAAGAGACAAGATATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATATCTTGTCTCTTTAGTCTGCAT 3' ||||||||||||||||||||||||| 3' GTATAGAACAGAGAAATCAGACGTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:55875768..55875792 21/25 unknown
tropicalis 10.0 Chr5:150617714..150617738 25/25 Antisense target gata4
Chr5:150617714..150617738 25/25 Sense off-target fam167a
Publications
First: GATA4 and GATA5 are essential for heart and liver development in Xenopus embryos., BMC Dev Biol 2008                          
Most recent: Genome-wide transcriptomics analysis of genes regulated by GATA4, 5 and 6 during cardiomyogenesis in Xenopus laevis., Data Brief 2018    
View All Papers