Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249613

Morpholino Name: gata5 MO4
Synonyms: G5SP MO, GATA5 sp
Target mRNA: gata5

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGGAGGACTGTGGGACGGAGAGAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25 22/25
genomic

MO
5' GTCTCTCCGTCCCACAGTCCTCCTC 3' ||||||||||||||||||||||||| 3' CAGAGAGGCAGGGTGTCAGGAGGAG 5' 5' GTCTGTCTGTCCCACAGTCTTCCTC 3' |||| || ||||||||||| ||||| 3' CAGAGAGGCAGGGTGTCAGGAGGAG 5' 5' GTCTGTCTGTCCCACAGTCTTCCTC 3' |||| || ||||||||||| ||||| 3' CAGAGAGGCAGGGTGTCAGGAGGAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:14622978..14623002 22/25 Antisense target gata5.L
Chr9_10S:13266183..13266207 22/25 Antisense target gata5.S
Chr9_10L:14622978..14623002 22/25 Sense off-target LOC108700924
tropicalis 10.0 Chr10:4879407..4879431 25/25 Antisense target gata5
Chr10:4879407..4879431 25/25 Sense off-target LOC116408023
Publications
First: GATA4 and GATA5 are essential for heart and liver development in Xenopus embryos., BMC Dev Biol 2008                          
Most recent: Genome-wide transcriptomics analysis of genes regulated by GATA4, 5 and 6 during cardiomyogenesis in Xenopus laevis., Data Brief 2018    
View All Papers