Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249614

Morpholino Name: gata6 MO1
Synonyms: MDL MO, gata6
Target mRNA: gata6

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTGTCCTCACTCAGGTCCATCCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' TGGATGGACCTGAATGAGGACAGCT 3' ||||||||||||| ||||||||||| 3' ACCTACCTGGACTCACTCCTGTCGA 5' 5' TGGATGGACCTGAGTGAGGACAGCT 3' ||||||||||||||||||||||||| 3' ACCTACCTGGACTCACTCCTGTCGA 5' 5' TGGATGGACCTGAATGAGGACTGCT 3' ||||||||||||| ||||||| ||| 3' ACCTACCTGGACTCACTCCTGTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:108638094..108638118 25/25 Antisense target gata6.L
chr6S:86167385..86167409 23/25 Antisense target gata6.S
tropicalis 10.0 Chr6:108766937..108766961 24/25 Antisense target gata6
Publications
First: GATA-6 maintains BMP-4 and Nkx2 expression during cardiomyocyte precursor maturation., EMBO J 2003  
Most recent: Genome-wide transcriptomics analysis of genes regulated by GATA4, 5 and 6 during cardiomyogenesis in Xenopus laevis., Data Brief 2018    
View All Papers