Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249615

Morpholino Name: gata6 MO2
Synonyms: MYQ MO, gata6
Target mRNA: gata6

Morpholino Type: uncategorized morpholino
Sequence: 5' GTAAGTGTCTGGTATATGTCCCCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25 24/25
genomic

MO
5' CCGGGGACATGTACCAGACACTTAC 3' | |||||||| |||||||||||||| 3' GACCCCTGTATATGGTCTGTGAATG 5' 5' CTGGGGACATGTACCAGACACTTAC 3' |||||||||| |||||||||||||| 3' GACCCCTGTATATGGTCTGTGAATG 5' 5' CTGGGGACATGTACCAGACACTTAC 3' |||||||||| |||||||||||||| 3' GACCCCTGTATATGGTCTGTGAATG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:108638422..108638446 24/25 Antisense target gata6.L
chr6S:86167713..86167737 24/25 Antisense target gata6.S
chr7L:85041744..85041768 21/25 Sense off-target ski.L
tropicalis 10.0 Chr6:108767265..108767289 23/25 Antisense target gata6
Publications
First: GATA-6 maintains BMP-4 and Nkx2 expression during cardiomyocyte precursor maturation., EMBO J 2003  
Most recent: Genome-wide transcriptomics analysis of genes regulated by GATA4, 5 and 6 during cardiomyogenesis in Xenopus laevis., Data Brief 2018    
View All Papers