Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249620

Morpholino Name: gdf11.1 MO2
Synonyms: xGDF11 tMO
Target mRNA: gdf11.1

Morpholino Type: translation blocking morpholino
Sequence: 5' ACAGAGGGCACAGCTGAGACAGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGCTGTCTCAGCTGTGTCCTCTGT 3' ||||||||||||||||| ||||||| 3' TACGACAGAGTCGACACGGGAGACA 5' 5' ATGCTGTCTCAGCTGTGCCCTCTGT 3' ||||||||||||||||||||||||| 3' TACGACAGAGTCGACACGGGAGACA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:144974172..144974196 25/25 Antisense target gdf11.1.L
Chr2L:144980447..144980471 25/25 Antisense target gdf11.1.L
Chr2S:129715745..129715769 24/25 Antisense off-target LOC108709836
Chr2S:129721750..129721774 24/25 Antisense off-target LOC108709836
Chr6S:71751208..71751232 21/25 Antisense off-target LOC108720089
tropicalis 10.0 Chr2:138079164..138079188 24/25 Antisense target gdf11.1
Chr7:132341986..132342010 21/25 Antisense off-target cplane2
Chr8:42735972..42735996 21/25 unknown
Publications
First: The role and regulation of GDF11 in Smad2 activation during tailbud formation in the Xenopus embryo., Mech Dev 2010                    
Most recent:
View All Papers