Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249664

Morpholino Name: h3f3a MO1
Synonyms: H3 MO1
Target mRNA: h3-3a

Morpholino Type: uncategorized morpholino
Sequence: 5' TGTACGGGCCATTTCCCTTTAATCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' CGACTAAAGGGAAATGGCCCGTACC 3' ||| |||||||||||||||||||| 3' GCTAATTTCCCTTTACCGGGCATGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:12220629..12220653 25/25 Antisense off-target h3-5.S
chr5L:17227392..17227416 24/25 Antisense off-target h3-5.L
chr4S:56361857..56361881 21/25 unknown
tropicalis 10.0 Chr5:8210005..8210029 23/25 Antisense target h3-3a
Publications
First: Optimal histone H3 to linker histone H1 chromatin ratio is vital for mesodermal competence in Xenopus., Development 2013                                                
Most recent:
View All Papers