Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249665

Morpholino Name: h3f3a MO2
Synonyms: H3 MO2
Target mRNA: h3-3a

Morpholino Type: uncategorized morpholino
Sequence: 5' GCGGTCTGCTTGGTACGAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/23
genomic

MO
5' ATGGCCCGTACCAAGCAGACAGC 3' ||||| |||||||||||||| || 3' TACCGAGCATGGTTCGTCTGGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold22:1205798..1205820 23/23 Sense off-target Xetrov90029514m.L
Scaffold29:2245920..2245942 23/23 Antisense off-target LOC108704298 [provisional:h3c7]
Scaffold29:2245920..2245942 23/23 Antisense off-target LOC108704294
Scaffold29:2648035..2648057 23/23 Antisense off-target LOC108704265
Scaffold29:2648035..2648057 23/23 Antisense off-target LOC108704296 [provisional:h3c7]
Scaffold22:1205798..1205820 23/23 Antisense off-target LOC108703833
Scaffold22:1736645..1736667 23/23 Antisense off-target LOC108703784 [provisional:h3c7]
chr6S:1901998..1902020 23/23 Antisense off-target LOC108695575 [provisional:h3c7]
Scaffold22:1857250..1857272 22/23 Antisense off-target LOC108703777
Scaffold22:1893808..1893830 22/23 Antisense off-target LOC108703804 [provisional:h3c7]
Scaffold22:1893808..1893830 22/23 Sense off-target XB5900552.L [provisional]
Scaffold22:2309624..2309646 22/23 Antisense off-target Xelaev18001465m
Scaffold22:2309624..2309646 22/23 Sense off-target XB5900552.L [provisional]
Scaffold22:2309624..2309646 22/23 Antisense off-target LOC108703802
Scaffold29:2911042..2911064 22/23 Antisense off-target LOC108704297 [provisional:h3c7]
Scaffold3113:506..528 22/23 Antisense off-target LOC108705881 [provisional:h3c7]
Scaffold22:1857250..1857272 22/23 Sense off-target LOC108703769
Scaffold22:1857250..1857272 22/23 Antisense off-target LOC108703785 [provisional:h3c7]
chr5S:6171796..6171818 22/23 Antisense off-target h3c8.S
chr5S:6773662..6773684 22/23 Antisense off-target Xelaev18028550m
chr5S:6786579..6786601 22/23 Antisense off-target Xelaev18028555m
Scaffold324:12681..12703 21/23 Antisense off-target LOC108705672 [provisional:h3c7]
chr9_10L:37011610..37011632 21/23 Antisense off-target h3-3b.L
chr9_10L:97410750..97410772 21/23 Antisense off-target LOC108701569 [provisional:h3-3b]
chr9_10S:87367469..87367491 21/23 Antisense off-target h3c13.S
chr5L:17227405..17227427 21/23 Antisense off-target h3-5.L
chr5L:23137756..23137778 21/23 Antisense off-target LOC108716540 [provisional:h3c7]
chr5L:23181022..23181044 21/23 Antisense off-target LOC108716541 [provisional:h3c7]
chr5S:12220618..12220640 21/23 Antisense off-target h3-5.S
chr2S:14912752..14912774 20/23 Antisense off-target crybg3.S
Scaffold104096:28..50 23/23 unknown
Scaffold28815:576..598 23/23 unknown
Scaffold22:1323430..1323452 23/23 unknown
Scaffold107314:152..174 22/23 unknown
Scaffold17831:28..50 22/23 unknown
Scaffold11084:902..924 21/23 unknown
chr5L:23122003..23122025 21/23 unknown
tropicalis 10.0 Chr5:8209994..8210016 21/23 Antisense target h3-3a
Chr6:4062807..4062829 23/23 Antisense off-target LOC100487179
Chr6:4055613..4055635 22/23 Sense off-target LOC116411632
Chr6:4055613..4055635 22/23 Antisense off-target LOC101732029
Chr6:4059548..4059570 22/23 Sense off-target LOC101734931
Chr6:4059548..4059570 22/23 Antisense off-target LOC101732029
Chr6:4245944..4245966 22/23 Antisense off-target LOC100487139
Chr6:4308192..4308214 22/23 Antisense off-target LOC100486720
Chr6:4852643..4852665 22/23 Antisense off-target LOC116411630
Chr6:4852643..4852665 22/23 Sense off-target LOC101733242
Chr6:5109909..5109931 22/23 Antisense off-target LOC100497127
Chr6:5269746..5269768 22/23 Antisense off-target LOC116411629
Chr6:4252503..4252525 22/23 Antisense off-target LOC100496027
Chr6:5288979..5289001 22/23 Antisense off-target LOC100493100
Chr9:2677792..2677814 22/23 Antisense off-target LOC101731074
Chr9:2727436..2727458 22/23 Antisense off-target LOC100488698
Chr9:2727436..2727458 22/23 Antisense off-target h3c13
Chr9:2833099..2833121 22/23 Sense off-target LOC101731959
Chr9:2833099..2833121 22/23 Antisense off-target LOC108648869
Chr9:2891955..2891977 22/23 Antisense off-target LOC100493036
Chr9:2954381..2954403 22/23 Sense off-target LOC116407589
Chr9:2954381..2954403 22/23 Antisense off-target LOC100494884
Chr9:2965515..2965537 22/23 Antisense off-target LOC100486653
Chr9:2989983..2990005 22/23 Antisense off-target LOC100486653
Chr9:2989983..2990005 22/23 Sense off-target LOC100493706
Chr9:3506194..3506216 22/23 Sense off-target LOC105945443
Chr9:3506194..3506216 22/23 Antisense off-target LOC101730986
Chr9:3506194..3506216 22/23 Sense off-target h2ac14
Chr9:4257129..4257151 22/23 Antisense off-target LOC116406473
Chr9:4565863..4565885 22/23 Antisense off-target LOC100485665
Chr9:4578573..4578595 22/23 Antisense off-target LOC105947137
Chr9:4747346..4747368 22/23 Antisense off-target LOC100487628
Chr9:4747346..4747368 22/23 Antisense off-target LOC116406469
Chr9:4803195..4803217 22/23 Sense off-target LOC100487628
Chr9:4803195..4803217 22/23 Antisense off-target LOC108645245
Chr9:4807102..4807124 22/23 Sense off-target LOC100487628
Chr9:4807102..4807124 22/23 Antisense off-target LOC101733224
Chr9:4894194..4894216 22/23 Sense off-target h2aj
Chr9:4894194..4894216 22/23 Antisense off-target LOC101730415
Chr9:4910105..4910127 22/23 Antisense off-target LOC116407578
Chr9:4974890..4974912 22/23 Sense off-target LOC100497614
Chr9:4974890..4974912 22/23 Antisense off-target LOC116407579
Chr9:4988961..4988983 22/23 Sense off-target LOC100497614
Chr9:5024646..5024668 22/23 Antisense off-target LOC101730642
Chr9:5558102..5558124 22/23 Antisense off-target LOC100497406
Chr9:5608828..5608850 22/23 Sense off-target LOC116407737
Chr9:5608828..5608850 22/23 Antisense off-target LOC116407634
Chr9:5615686..5615708 22/23 Antisense off-target LOC116407634
Chr9:2692042..2692064 21/23 Sense off-target LOC100488698
Chr9:2692042..2692064 21/23 Antisense off-target LOC100487756
Chr9:2692042..2692064 21/23 Antisense off-target LOC100487588
Chr9:2809830..2809852 22/23 unknown
Chr9:2819321..2819343 22/23 unknown
Chr9:4262073..4262095 22/23 unknown
Chr9:5010739..5010761 22/23 unknown
Publications
First: Optimal histone H3 to linker histone H1 chromatin ratio is vital for mesodermal competence in Xenopus., Development 2013                                                
Most recent:
View All Papers