Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249669

Morpholino Name: has1 MO1
Synonyms: Has1-Mo1
Target mRNA: has1

Morpholino Type: uncategorized morpholino
Sequence: 5' CACACACATGGGATATGCCAAGTTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AAACTTGGCATATCCCATGTGTGTG 3' ||||||||||||||||||||||||| 3' TTTGAACCGTATAGGGTACACACAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:1587924..1587948 25/25 Antisense target has1.S
chr2L:75637622..75637646 21/25 unknown
tropicalis 10.0 Chr10:5230345..5230369 21/25 Antisense off-target c20orf85
Publications
First: Hyaluronan is required for cranial neural crest cells migration and craniofacial development., Dev Dyn 2012                
Most recent:
View All Papers