Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249671

Morpholino Name: has2 MO1
Synonyms: Has2 MO 1, XHas2-Mo1
Target mRNA: has2

Morpholino Type: uncategorized morpholino
Sequence: 5' GTTATTGCCTTGGTCCTGTGGTCAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GTGACCATAGGACCAAGGCAATAAC 3' ||||||| ||||||||||||||||| 3' CACTGGTGTCCTGGTTCCGTTATTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:88493518..88493542 21/25 Antisense off-target dsc3.S
Scaffold942:1690..1714 21/25 unknown
chr7L:78225265..78225289 21/25 unknown
tropicalis 10.0 Chr6:139323083..139323107 24/25 Antisense target has2
Chr5:27921280..27921304 21/25 unknown
Publications
First: XHas2 activity is required during somitogenesis and precursor cell migration in Xenopus development., Development 2006                          
Most recent: Hyaluronan is required for cranial neural crest cells migration and craniofacial development., Dev Dyn 2012                
View All Papers