Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249689

Morpholino Name: hesx1 MO1
Synonyms: TNeu069m07, Xtanf-1, anf-1
Target mRNA: hesx1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTTTCTGAAGACCAGGAGACATGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' CCATGTCTCCTGGTCTTCAGAAAGG 3' ||||||||||||||||||||||||| 3' GGTACAGAGGACCAGAAGTCTTTCC 5' 5' CCATGTCTCCTGCTCTTCAGAAAGG 3' |||||||||||| |||||||||||| 3' GGTACAGAGGACCAGAAGTCTTTCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold24:199742..199766 24/25 Antisense target hesx1.L
chr5L:21418544..21418568 21/25 Antisense off-target LOC108716514 [provisional:kif6]
Scaffold92497:59..83 22/25 unknown
chr3L:93628480..93628504 21/25 unknown
chr3S:49675497..49675521 21/25 unknown
tropicalis 10.0 Chr4:148686781..148686805 25/25 Antisense target hesx1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers