Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249692

Morpholino Name: hey1 MO1
Synonyms: Hesr1
Target mRNA: hey1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTGTAATCGTGTCCCCGCTTCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' CATGAAGCGGGGACACGATTACAGC 3' ||||||||||||||||||||||||| 3' GTACTTCGCCCCTGTGCTAATGTCG 5' 5' CATGAAGCGGGGACACGACTACAGC 3' |||||||||||||||||| |||||| 3' GTACTTCGCCCCTGTGCTAATGTCG 5' 5' CATGAAGCGGGGACACGACTACAGC 3' |||||||||||||||||| |||||| 3' GTACTTCGCCCCTGTGCTAATGTCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:133084791..133084815 24/25 Antisense target hey1.L
Chr6S:109365841..109365865 24/25 Antisense target hey1.S
Chr1L:23394021..23394045 24/25 Sense off-target grk4.L
Chr1L:23394592..23394616 24/25 Antisense off-target grk4.L
Chr2S:146770006..146770030 24/25 Sense off-target LOC108709955
Chr2S:32524409..32524433 24/25 Antisense off-target LOC108709326
Chr3S:124376775..124376799 24/25 Antisense off-target odad3.S
Chr4L:58165063..58165087 24/25 Antisense off-target plcg2.L
Chr4L:58165672..58165696 24/25 Sense off-target plcg2.L
Chr4S:57441301..57441325 24/25 Antisense off-target phkb.S
Chr4S:57441865..57441889 24/25 Sense off-target phkb.S
Chr5L:132371628..132371652 24/25 Sense off-target cul3.L
Chr5L:132372201..132372225 24/25 Antisense off-target cul3.L
Chr5L:45981947..45981971 24/25 Sense off-target utrn.L
Chr5L:45982518..45982542 24/25 Antisense off-target utrn.L
Chr5S:107190990..107191014 24/25 Sense off-target xrn1.S
Chr3L:63590549..63590573 24/25 Antisense off-target LOC121401488
Chr8S:79243171..79243195 24/25 Antisense off-target LOC108700560
Chr8S:79243692..79243716 24/25 Sense off-target LOC108700560
Chr9_10L:105191596..105191620 24/25 Sense off-target mad1l1.L
Chr2S:107690045..107690069 23/25 Sense off-target arhgef7.S
Chr2S:32525029..32525053 23/25 Sense off-target LOC108709326
Chr3S:124377349..124377373 23/25 Sense off-target odad3.S
Chr5L:58952120..58952144 23/25 Antisense off-target LOC101027285
Chr6S:36129880..36129904 23/25 Antisense off-target LOC108719941
Chr7L:9259356..9259380 23/25 Sense off-target LOC108695740
Chr1S:177604435..177604459 24/25 unknown
Chr2S:158565429..158565453 24/25 unknown
Chr2S:47335821..47335845 24/25 unknown
Chr3S:19211183..19211207 24/25 unknown
Chr3S:19211792..19211816 23/25 unknown
Chr4S:25237711..25237735 23/25 unknown
Chr7L:68361250..68361274 23/25 unknown
Chr8S:19611312..19611336 23/25 unknown
Chr8S:69972708..69972732 23/25 unknown
Chr1S:95067749..95067773 21/25 unknown
Chr7L:50431767..50431791 21/25 unknown
tropicalis 10.0 Chr6:123459194..123459218 25/25 Antisense target hey1
Publications
First: Microarray-based identification of VegT targets in Xenopus., Mech Dev 2005                                            
Most recent:
View All Papers