Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249712

Morpholino Name: hmx3 MO1
Synonyms: hmx3
Target mRNA: hmx3

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCCTGTCCTGTCTCGGGCATGATA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25
genomic

MO
5' CATCATGCCTGAGACAGGACAGGAG 3' |||||||| ||||||||||||||| 3' ATAGTACGGGCTCTGTCCTGTCCTC 5' 5' TATCATGCCTGAGACAGGACAGGAG 3' ||||||||| ||||||||||||||| 3' ATAGTACGGGCTCTGTCCTGTCCTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:14849126..14849150 24/25 Antisense target hmx3.L
tropicalis 10.0 Chr7:20125705..20125729 23/25 Antisense target hmx3
Publications
First: The homeodomain-containing transcription factor X-nkx-5.1 inhibits expression of the homeobox gene Xanf-1 during the Xenopus laevis forebrain development., Mech Dev 2004    
Most recent:
View All Papers