Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249718

Morpholino Name: homez MO1
Synonyms: Homez MO, Homez antisense morpholino
Target mRNA: homez

Morpholino Type: uncategorized morpholino
Sequence: 5' GGGTCATTCTCAGCTTATGAAGGTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TACCTTAATAAGCTGAGAATGACCC 3' |||||| |||||||||||||||||| 3' ATGGAAGTATTCGACTCTTACTGGG 5' 5' TACCTTCATAAGCTGAGAATGACCC 3' ||||||||||||||||||||||||| 3' ATGGAAGTATTCGACTCTTACTGGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:150782738..150782762 25/25 Antisense target homez.L
tropicalis 10.0 Chr1:139646177..139646201 24/25 Antisense target homez
Chr5:159855618..159855642 22/25 unknown
Publications
First: The homeobox leucine zipper gene Homez plays a role in Xenopus laevis neurogenesis., Biochem Biophys Res Commun 2011              
Most recent:
View All Papers