Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249740

Morpholino Name: id3 MO1
Synonyms: Id3 MO, Id3-MO
Target mRNA: id3

Morpholino Type: uncategorized morpholino
Sequence: 5' GGGTGTCAGAGATGATTGCTGGAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25
genomic

MO
5' GCTCCAGCAATCATCTCTGACACCC 3' ||||||||||||||||||||||||| 3' CGAGGTCGTTAGTAGAGACTGTGGG 5' 5' GCTCCAGCAATCTTCTCCGACATCA 3' |||||||||||| |||| |||| | 3' CGAGGTCGTTAGTAGAGACTGTGGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:57932912..57932936 25/25 Antisense target id3.L
chr2S:63949873..63949897 21/25 Antisense target id3.S
tropicalis 10.0 Chr4:41587783..41587807 21/25 Antisense off-target rpgrip1l
Chr4:88573607..88573631 21/25 Antisense off-target szt2
Chr4:88611323..88611347 21/25 Antisense off-target szt2
Chr7:50799662..50799686 21/25 Sense off-target tspan14
Publications
First: To proliferate or to die: role of Id3 in cell cycle progression and survival of neural crest progenitors., Genes Dev 2005              
Most recent: Self-regulation of Stat3 activity coordinates cell-cycle progression and neural crest specification., EMBO J 2010  
View All Papers