Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249741

Morpholino Name: id3 MO2
Synonyms: ID3, Id3 MO
Target mRNA: id3

Morpholino Type: uncategorized morpholino
Sequence: 5' ACCGCACTGGGCTGATGGCTTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' ATGAAAGCCATCAGCCCAGTGAGGT 3' ||||||||||||||||||||| ||| 3' TACTTTCGGTAGTCGGGTCACGCCA 5' 5' ATGAAAGCCATCAGCCCAGTGCGGT 3' ||||||||||||||||||||||||| 3' TACTTTCGGTAGTCGGGTCACGCCA 5' 5' ATGAAAGCCATCAGCCCAGTGAGGT 3' ||||||||||||||||||||| ||| 3' TACTTTCGGTAGTCGGGTCACGCCA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:57932942..57932966 25/25 Antisense target id3.L
chr2S:63949843..63949867 24/25 Antisense target id3.S
tropicalis 10.0 Chr2:78346761..78346785 24/25 Antisense target id3
Publications
First: Xenopus Id3 is required downstream of Myc for the formation of multipotent neural crest progenitor cells., Development 2005                
Most recent: Hairy2-Id3 interactions play an essential role in Xenopus neural crest progenitor specification., Dev Biol 2008                            
View All Papers