Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249742

Morpholino Name: id3 MO3
Synonyms: miR-219 MO
Target mRNA: id3

Morpholino Type: uncategorized morpholino
Sequence: 5' CAAGAATTGCGTTTGGACAATCAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold36:652018..652042 25/25 Antisense off-target Xelaev18002814m
chr8S:32552494..32552518 25/25 unknown
chr6L:39939610..39939634 21/25 unknown
tropicalis 10.0 Chr8:25809087..25809111 25/25 Antisense off-target mir219
Publications
First: FMR1/FXR1 and the miRNA pathway are required for eye and neural crest development., Dev Biol 2010                                                                
Most recent:
View All Papers