Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249743

Morpholino Name: id3 MO4
Synonyms: 16G8moA
Target mRNA: id3

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGCTTTCATGGTGGCGTCAGAGAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATCTCTGACGCCACCATGAAAGCCA 3' ||||||||||||||||||||||||| 3' TAGAGACTGCGGTGGTACTTTCGGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:110734334..110734358 22/25 unknown
tropicalis 10.0 Chr2:78346776..78346800 25/25 Antisense target id3
Chr5:44071079..44071103 21/25 Sense off-target acat2
Chr6:149275086..149275110 21/25 Antisense off-target LOC105945167
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers