Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249744

Morpholino Name: id3 MO5
Synonyms: 16G8moB
Target mRNA: id3

Morpholino Type: uncategorized morpholino
Sequence: 5' GACCTCACTGGGCTGATGGCTTTCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' TGAAAGCCATCAGCCCAGTGAGGTC 3' ||||||||||||||||||||||||| 3' ACTTTCGGTAGTCGGGTCACTCCAG 5' 5' TGAAAGCCATCAGCCCAGTGCGGTC 3' |||||||||||||||||||| |||| 3' ACTTTCGGTAGTCGGGTCACTCCAG 5' 5' TGAAAGCCATCAGCCCAGTGAGGTC 3' ||||||||||||||||||||||||| 3' ACTTTCGGTAGTCGGGTCACTCCAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:63949842..63949866 25/25 Antisense target id3.S
chr2L:57932943..57932967 24/25 Antisense target id3.L
chr1L:157820062..157820086 21/25 unknown
chr4L:5869950..5869974 21/25 unknown
tropicalis 10.0 Chr2:78346760..78346784 25/25 Antisense target id3
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers