Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249745

Morpholino Name: ier2 MO1
Synonyms: XIer2a MO
Target mRNA: ier2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCATCTCACTTTCCAATGCTGAACC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGTTCAGCATTGGAAAGTGAGATGG 3' ||||||||||||||||||||||||| 3' CCAAGTCGTAACCTTTCACTCTACC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:133251250..133251274 25/25 Antisense target ier2.L
chr1S:143818554..143818578 22/25 unknown
Scaffold20:5365852..5365876 21/25 unknown
tropicalis 10.0 Chr5:71434257..71434281 21/25 unknown
Publications
First: XIer2 is required for convergent extension movements during Xenopus development., Int J Dev Biol 2011                    
Most recent:
View All Papers