Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249746

Morpholino Name: ier2 MO2
Synonyms: XIer2b MO
Target mRNA: ier2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCATCTTGTGCTGCTTCTTCCGCGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr1:167203230..167203254 21/25 Sense off-target chsy3
Chr9:86621600..86621624 21/25 Antisense off-target ercc3
Publications
First: XIer2 is required for convergent extension movements during Xenopus development., Int J Dev Biol 2011                    
Most recent:
View All Papers